| Basic information from miRBase |
| hairpin accession number: MI0003001 |
| Located between position 464 and 547 on chromosome 1099214568803 strand - |
| mature miRNAs for MI0003001: |
| mml-miR-17-5p (MIMAT0002700): CAAAGTGCTTACAGTGCAGGTAGT |
| mml-miR-17-3p (MIMAT0002701): ACTGCAGTGAAGGCACTTGT |
| You can find this miRNA in EMBL: AY866315 (accession: AY866315) |
| References |
| [1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain" |
| [2]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |