| Basic information from miRBase |
| hairpin accession number: MI0002808 |
| Located between position 11055206 and 11055315 on chromosome 15 strand - |
| mature miRNAs for MI0002808: |
| mml-miR-181a (MIMAT0002506): AACATTCAACGCTGTCGGTGAGT |
| You can find this miRNA in EMBL: AY866167 (accession: AY866167) |
| References |
| [1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain" |
| [2]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |