| Basic information from miRBase |
| hairpin accession number: MI0007646 |
| Located between position 11053981 and 11054069 on chromosome 15 strand - |
| mature miRNAs for MI0007646: |
| mml-miR-181b (MIMAT0002623): AACATTCATTGCTGTCGGTGGGTT |
| You can find this miRNA in ENTREZGENE: MIR181B-2 (accession: 100315209) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |