| Basic information from miRBase |
| hairpin accession number: MI0007647 |
| Located between position 13558675 and 13558811 on chromosome 19 strand + |
| mature miRNAs for MI0007647: |
| mml-miR-181d (MIMAT0006217): AACATTCATTGTTGTCGGTGGGT |
| You can find this miRNA in ENTREZGENE: MIR181D (accession: 100315210) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |