| Basic information from miRBase |
| hairpin accession number: MI0007648 |
| Located between position 58339711 and 58339794 on chromosome 7 strand + |
| mature miRNAs for MI0007648: |
| mml-miR-184 (MIMAT0006218): TGGACGGAGAACTGATAAGGGT |
| You can find this miRNA in ENTREZGENE: MIR184 (accession: 100315516) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |