| Basic information from miRBase |
| hairpin accession number: MI0007649 |
| Located between position 64097640 and 64097721 on chromosome 10 strand + |
| mature miRNAs for MI0007649: |
| mml-miR-185 (MIMAT0006219): TGGAGAGAAAGGCAGTTCCTGA |
| You can find this miRNA in ENTREZGENE: MIR185 (accession: 100315449) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |