| Basic information from miRBase |
| hairpin accession number: MI0007650 |
| Located between position 73831020 and 73831105 on chromosome 1 strand - |
| Overlapping with sense strand of XM_001099498.1 (intron 8). |
| (Ensemble: ENSMMUT00000024337) |
| mature miRNAs for MI0007650: |
| mml-miR-186 (MIMAT0006220): CAAAGAATTCTCCTTTTGGGCT |
| You can find this miRNA in ENTREZGENE: MIR186 (accession: 100315211) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |