| Basic information from miRBase |
| hairpin accession number: MI0007651 |
| Located between position 28861007 and 28861115 on chromosome 18 strand - |
| mature miRNAs for MI0007651: |
| mml-miR-187 (MIMAT0006221): TCGTGTCTTGTGTTGCAGCCGG |
| You can find this miRNA in ENTREZGENE: MIR187 (accession: 100315398) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |