| Basic information from miRBase |
| hairpin accession number: MI0002608 |
| Located between position 47638603 and 47638688 on chromosome X strand + |
| Overlapping with sense strand of XM_001083068.1 (intron 3). |
| (Ensemble: ENSMMUT00000032444) |
| mature miRNAs for MI0002608: |
| mml-miR-188 (MIMAT0002307): CATCCCTTGCATGGTGGAGGGT |
| You can find this miRNA in EMBL: AY865946 (accession: AY865946) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |