| Basic information from miRBase |
| hairpin accession number: MI0007590 |
| Located between position 132387530 and 132387600 on chromosome X strand - |
| mature miRNAs for MI0007590: |
| mml-miR-18b (MIMAT0006163): TAAGGTGCATCTAGTGCAGTTAG |
| You can find this miRNA in ENTREZGENE: MIR18B (accession: 100315179) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |