miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002613
Located between position 41206805 and 41206889 on chromosome 7 strand +
Overlapping with sense strand of XM_001101608.1 (intron 51).
(Ensemble: ENSMMUT00000040471)
mature miRNAs for MI0002613:
         mml-miR-190a (MIMAT0002312): TGATATGTTTGATATATTAGGT
You can find this miRNA in EMBL: AY865951 (accession: AY865951)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"