| Basic information from miRBase |
| hairpin accession number: MI0007652 |
| Located between position 132712583 and 132712661 on chromosome 1 strand - |
| mature miRNAs for MI0007652: |
| mml-miR-190b (MIMAT0006222): TGATATGTTTGATATTGGGTT |
| You can find this miRNA in ENTREZGENE: MIR190B (accession: 100315212) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |