| Basic information from miRBase |
| hairpin accession number: MI0007655 |
| Located between position 26739889 and 26739973 on chromosome 16 strand + |
| mature miRNAs for MI0007655: |
| mml-miR-193a-5p (MIMAT0006225): TGGGTCTTTGCGGGCGAGATGA |
| mml-miR-193a-3p (MIMAT0006226): AACTGGCCTACAAAGTCCCAGT |
| You can find this miRNA in ENTREZGENE: MIR193A (accession: 100315214) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |