| Basic information from miRBase |
| hairpin accession number: MI0007599 |
| Located between position 43638917 and 43639005 on chromosome 1 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSMMUT00000020990) |
| mature miRNAs for MI0007599: |
| mml-miR-30c (MIMAT0006170): TGTAAACATCCTACACTCTCAGC |
| You can find this miRNA in ENTREZGENE: MIR30C-1 (accession: 100315184) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |