| Basic information from miRBase |
| hairpin accession number: MI0007605 |
| Located between position 109970674 and 109970750 on chromosome 14 strand + |
| mature miRNAs for MI0007605: |
| mml-miR-34c-5p (MIMAT0006175): AGGCAGTGTAGTTAGCTGATTGC |
| mml-miR-34c-3p (MIMAT0006176): AATCACTAACCACACGGCCAGG |
| You can find this miRNA in ENTREZGENE: MIR34C (accession: 100315187) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |