| Basic information from miRBase |
| hairpin accession number: MI0007809 |
| Located between position 59798513 and 59798599 on chromosome 19 strand + |
| mature miRNAs for MI0007809: |
| mml-miR-523a (MIMAT0006399): AATGCGCTTCCCTTTAGAGGG |
| You can find this miRNA in ENTREZGENE: MIR523A (accession: 100315297) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |