| Basic information from miRBase |
| hairpin accession number: MI0007810 |
| Located between position 59835044 and 59835132 on chromosome 19 strand + |
| mature miRNAs for MI0007810: |
| mml-miR-523b (MIMAT0006400): CTCTAGAGCGAAGCGCTTTCTG |
| You can find this miRNA in ENTREZGENE: MIR523B (accession: 100315602) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |