| Basic information from miRBase |
| hairpin accession number: MI0007813 |
| Located between position 59797667 and 59797752 on chromosome 19 strand + |
| mature miRNAs for MI0007813: |
| mml-miR-525 (MIMAT0006402): CTCCAGAGGGATGCACTTTCT |
| You can find this miRNA in ENTREZGENE: MIR525 (accession: 100315416) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |