| Basic information from miRBase |
| hairpin accession number: MI0007814 |
| Located between position 47638245 and 47638322 on chromosome X strand + |
| Overlapping with sense strand of XM_001083068.1 (intron 3). |
| (Ensemble: ENSMMUT00000032444) |
| mature miRNAs for MI0007814: |
| mml-miR-532-5p (MIMAT0006403): CATGCCTTGAGTGTAGGACCGT |
| mml-miR-532-3p (MIMAT0006404): CCTCCCACACCCAAGGCTTGCA |
| You can find this miRNA in ENTREZGENE: MIR532 (accession: 100315299) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |