| Basic information from miRBase |
| hairpin accession number: MI0007815 |
| Located between position 164331808 and 164331885 on chromosome 7 strand + |
| mature miRNAs for MI0007815: |
| mml-miR-539 (MIMAT0006405): GGAGAAATTATCCTTGGTGTGT |
| You can find this miRNA in ENTREZGENE: MIR539 (accession: 100315300) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |