| Basic information from miRBase |
| hairpin accession number: MI0007816 |
| Located between position 132766718 and 132766814 on chromosome X strand - |
| mature miRNAs for MI0007816: |
| mml-miR-542-5p (MIMAT0006406): TCGGGGATCATCATGTCACGAGA |
| mml-miR-542-3p (MIMAT0006407): TGTGACAGATTGATAACTGAAA |
| You can find this miRNA in ENTREZGENE: MIR542 (accession: 100315547) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |