| Basic information from miRBase |
| hairpin accession number: MI0007817 |
| Located between position 164333144 and 164333234 on chromosome 7 strand + |
| mature miRNAs for MI0007817: |
| mml-miR-544 (MIMAT0006408): ATTCTGCATTTTTAGCAAGTTC |
| You can find this miRNA in ENTREZGENE: MIR544 (accession: 100315301) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |