| Basic information from miRBase |
| hairpin accession number: MI0007818 |
| Located between position 73379991 and 73380096 on chromosome X strand - |
| mature miRNAs for MI0007818: |
| mml-miR-545 (MIMAT0006409): TCAGCAAACATTTATTGTGTGC |
| You can find this miRNA in ENTREZGENE: MIR545 (accession: 100315463) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |