| Basic information from miRBase |
| hairpin accession number: MI0007819 |
| Located between position 18623089 and 18623186 on chromosome 4 strand + |
| mature miRNAs for MI0007819: |
| mml-miR-548a (MIMAT0006410): CAATACTGGCAATTACTTTTCC |
| You can find this miRNA in ENTREZGENE: MIR548A (accession: 100315417) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |