| Basic information from miRBase |
| hairpin accession number: MI0007820 |
| Located between position 144912371 and 144912467 on chromosome 4 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSMMUT00000039998) |
| mature miRNAs for MI0007820: |
| mml-miR-548b (MIMAT0006411): CAAAAACCTCAATTGCTTTTGT |
| You can find this miRNA in ENTREZGENE: MIR548B (accession: 100315302) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |