| Basic information from miRBase |
| hairpin accession number: MI0007821 |
| Located between position 128600436 and 128600530 on chromosome 4 strand - |
| mature miRNAs for MI0007821: |
| mml-miR-548c (MIMAT0006412): CAAAACCGGCAATTACTTCTGC |
| You can find this miRNA in ENTREZGENE: MIR548C (accession: 100315303) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |