| Basic information from miRBase |
| hairpin accession number: MI0007823 |
| Located between position 106991179 and 106991275 on chromosome 8 strand - |
| mature miRNAs for MI0007823: |
| mml-miR-548e (MIMAT0006415): CAAAACCGGCAGTTACTTTTGC |
| You can find this miRNA in ENTREZGENE: MIR548E (accession: 100315304) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |