| Basic information from miRBase |
| hairpin accession number: MI0007825 |
| Located between position 60001367 and 60001461 on chromosome 7 strand - |
| Overlapping with antisense strand of Q864A3_MACMU (intron 1). |
| (Ensemble: ENSMMUT00000002884) |
| mature miRNAs for MI0007825: |
| mml-miR-549 (MIMAT0006417): AGAGCTCATCCATAGTTGTCA |
| You can find this miRNA in ENTREZGENE: MIR549 (accession: 100315418) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |