| Basic information from miRBase |
| hairpin accession number: MI0007826 |
| Located between position 95919861 and 95919953 on chromosome 3 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSMMUT00000017584) |
| mature miRNAs for MI0007826: |
| mml-miR-550 (MIMAT0006418): AGTGCCTGAGGGAGTAAGAGCCC |
| You can find this miRNA in ENTREZGENE: MIR550 (accession: 100315306) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |