| Basic information from miRBase |
| hairpin accession number: MI0007827 |
| Located between position 6524006 and 6524101 on chromosome 1 strand - |
| Overlapping with sense strand of XR_010261.1 (intron 4). |
| (Ensemble: ENSMMUT00000013075) |
| mature miRNAs for MI0007827: |
| mml-miR-551a (MIMAT0006419): GCGACCCACTCTTGGTTTCCA |
| You can find this miRNA in ENTREZGENE: MIR551A (accession: 100315464) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |