| Basic information from miRBase |
| hairpin accession number: MI0007828 |
| Located between position 118520037 and 118520131 on chromosome 2 strand - |
| mature miRNAs for MI0007828: |
| mml-miR-551b (MIMAT0006420): GCGACCCATACTTGGTTTCAG |
| You can find this miRNA in ENTREZGENE: MIR551B (accession: 100315549) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |