| Basic information from miRBase |
| hairpin accession number: MI0007829 |
| Located between position 37469518 and 37469612 on chromosome 1 strand - |
| mature miRNAs for MI0007829: |
| mml-miR-552 (MIMAT0006421): AACGGGTGACTGGTTAGACAA |
| You can find this miRNA in ENTREZGENE: MIR552 (accession: 100315307) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |