| Basic information from miRBase |
| hairpin accession number: MI0007832 |
| Located between position 140873508 and 140873589 on chromosome 1 strand + |
| Overlapping with sense strand of XM_001115782.1 (intron 5). |
| (Ensemble: ENSMMUT00000006768) |
| mature miRNAs for MI0007832: |
| mml-miR-556-5p (MIMAT0006424): GATGAACTCATTGTAATATGAG |
| mml-miR-556-3p (MIMAT0006425): ATATTACAATTAGCTGATCTTT |
| You can find this miRNA in ENTREZGENE: MIR556 (accession: 100315309) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |