| Basic information from miRBase |
| hairpin accession number: MI0007835 |
| Located between position 96020650 and 96020744 on chromosome 12 strand + |
| Overlapping with sense strand of XM_001114025.1 (intron 9). |
| (Ensemble: ENSMMUT00000021267) |
| mature miRNAs for MI0007835: |
| mml-miR-562 (MIMAT0006428): AAAGTAGCTGTACCATTTGC |
| You can find this miRNA in ENTREZGENE: MIR562 (accession: 100315311) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |