| Basic information from miRBase |
| hairpin accession number: MI0007837 |
| Located between position 32211015 and 32211108 on chromosome 2 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSMMUT00000022602) |
| mature miRNAs for MI0007837: |
| mml-miR-567 (MIMAT0006430): ACTATGTTCTTCCAGGACAGAAC |
| You can find this miRNA in ENTREZGENE: MIR567 (accession: 100315419) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |