| Basic information from miRBase |
| hairpin accession number: MI0007838 |
| Located between position 34321762 and 34321855 on chromosome 2 strand - |
| mature miRNAs for MI0007838: |
| mml-miR-568 (MIMAT0006431): ATGTATAAATGTATACACAC |
| You can find this miRNA in ENTREZGENE: MIR568 (accession: 100315312) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |