| Basic information from miRBase |
| hairpin accession number: MI0007839 |
| Located between position 115944653 and 115944748 on chromosome 2 strand + |
| Overlapping with sense strand of (intron 20). |
| (Ensemble: ENSMMUT00000031321) |
| mature miRNAs for MI0007839: |
| mml-miR-569 (MIMAT0006432): AGTTAATGAATCCTGGAAAGT |
| You can find this miRNA in ENTREZGENE: MIR569 (accession: 100315551) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |