| Basic information from miRBase |
| hairpin accession number: MI0007840 |
| Located between position 4558697 and 4558776 on chromosome 6 strand - |
| mature miRNAs for MI0007840: |
| mml-miR-570 (MIMAT0006433): CAAAAGTAGCAATTACCTTTGC |
| You can find this miRNA in ENTREZGENE: MIR570 (accession: 100315313) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |