| Basic information from miRBase |
| hairpin accession number: MI0007841 |
| Located between position 2267998 and 2268092 on chromosome 20 strand - |
| Overlapping with sense strand of XP_001084468.1 (5UTR 1). |
| (Ensemble: ENSMMUT00000027025) |
| mature miRNAs for MI0007841: |
| mml-miR-572 (MIMAT0006434): GTCCGCTCGGCGGTGGCCCA |
| You can find this miRNA in ENTREZGENE: MIR572 (accession: 100315314) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |