| Basic information from miRBase |
| hairpin accession number: MI0007582 |
| Located between position 68219893 and 68220002 on chromosome 7 strand + |
| mature miRNAs for MI0007582: |
| mml-miR-7 (MIMAT0006159): TGGAAGACTAGTGATTTTGTTGT |
| You can find this miRNA in ENTREZGENE: MIR7-2 (accession: 100315503) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |