| Basic information from miRBase |
| hairpin accession number: MI0007583 |
| Located between position 4659068 and 4659177 on chromosome 19 strand + |
| Overlapping with sense strand of XM_001084345.1 (intron 2). |
| (Ensemble: ENSMMUT00000017626) |
| mature miRNAs for MI0007583: |
| mml-miR-7 (MIMAT0006159): TGGAAGACTAGTGATTTTGTTGT |
| You can find this miRNA in ENTREZGENE: MIR7-3 (accession: 100315504) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |