| Basic information from miRBase |
| hairpin accession number: MI0007584 |
| Located between position 135024723 and 135024811 on chromosome 1 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSMMUT00000025243) |
| mature miRNAs for MI0007584: |
| mml-miR-9 (MIMAT0006160): TCTTTGGTTATCTAGCTGTATGA |
| You can find this miRNA in ENTREZGENE: MIR9-1 (accession: 100315176) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |