| Basic information from miRBase |
| hairpin accession number: MI0007585 |
| Located between position 84955411 and 84955497 on chromosome 6 strand - |
| mature miRNAs for MI0007585: |
| mml-miR-9 (MIMAT0006160): TCTTTGGTTATCTAGCTGTATGA |
| You can find this miRNA in ENTREZGENE: MIR9-2 (accession: 100315391) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |