Basic information from miRBase |
hairpin accession number: MI0007586 |
Located between position 68995340 and 68995429 on chromosome 7 strand + |
mature miRNAs for MI0007586: |
mml-miR-9 (MIMAT0006160): TCTTTGGTTATCTAGCTGTATGA |
You can find this miRNA in ENTREZGENE: MIR9-3 (accession: 100315177) |
References |
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |