| Basic information from miRBase |
| hairpin accession number: MI0009921 |
| Located between position 119251786 and 119251875 on chromosome 11 strand + |
| mature miRNAs for MI0009921: |
| mmu-miR-1932 (MIMAT0009395): GTTGCGGACAGCGCTAGGTCGG |
| You can find this miRNA in ENTREZGENE: Mir1932 (accession: 100316690) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |