| Basic information from miRBase |
| hairpin accession number: MI0009924 |
| Located between position 85336223 and 85336282 on chromosome 11 strand + |
| Overlapping with sense strand of Bcas3-006 (intron 1). |
| (Ensemble: OTTMUST00000002047) |
| mature miRNAs for MI0009924: |
| mmu-miR-1935 (MIMAT0009399): AGGCAGAGGCTGGCGGATCTCT |
| You can find this miRNA in MGI: Mir1935 (accession: 3836972) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |