| Basic information from miRBase |
| hairpin accession number: MI0009936 |
| Located between position 32267536 and 32267669 on chromosome 16 strand - |
| mature miRNAs for MI0009936: |
| mmu-miR-1946a (MIMAT0009412): AGCCGGGCAGTGGTGGCACACACTTTT |
| You can find this miRNA in MGI: Mir1946a (accession: 3837017) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |