| Basic information from miRBase |
| hairpin accession number: MI0009940 |
| Located between position 35714221 and 35714290 on chromosome 18 strand + |
| Overlapping with sense strand of SNORA74.2-201 (exon 1). |
| (Ensemble: ENSMUST00000157434) |
| mature miRNAs for MI0009940: |
| mmu-miR-1949 (MIMAT0009416): CTATACCAGGATGTCAGCATAGTT |
| You can find this miRNA in MGI: Mir1949 (accession: 3837022) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |