miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003533
Located between position 110960928 and 110961013 on chromosome 12 strand +
mature miRNAs for MI0003533:
         mmu-miR-376c* (MIMAT0005295): GTGGATATTCCTTCTATGTTTA
         mmu-miR-376c (MIMAT0003183): AACATAGAGGAAATTTCACGT
You can find this miRNA in MGI: Mir376c (accession: 3619381)

References
[1]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[2]Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K, Science. 315:1137-1140(2007)., "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[5]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


This microRNA is imprinted (based on ncRNAimprinted database)