| Basic information from miRBase |
| hairpin accession number: MI0016973 |
| Located between position 88166275 and 88166366 on chromosome 11 strand + |
| Overlapping with antisense strand of Msi2-006 (intron 11). |
| (Ensemble: OTTMUST00000018479) |
| mature miRNAs for MI0016973: |
| mmu-miR-378b (MIMAT0019348): CTGGACTTGGAGTCAGAAGA |
| References |
| [1]Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER, Genome Res. 20:1590-1604(2010)., "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" |